Review




Structured Review

GenScript corporation arid4b sgrna sequences
(A) Genotype distribution of progenies from the mating of <t>Arid4b</t> +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.
Arid4b Sgrna Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/arid4b sgrna sequences/product/GenScript corporation
Average 90 stars, based on 1 article reviews
arid4b sgrna sequences - by Bioz Stars, 2026-05
90/100 stars

Images

1) Product Images from "Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling"

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

Journal: Cell reports

doi: 10.1016/j.celrep.2021.110036

(A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.
Figure Legend Snippet: (A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.

Techniques Used: Staining

(A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.
Figure Legend Snippet: (A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.

Techniques Used: Transplantation Assay, Injection, Irradiation, Flow Cytometry

(A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.
Figure Legend Snippet: (A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.

Techniques Used: Immunofluorescence, Staining, Flow Cytometry, Immunohistochemistry, Western Blot

(A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).
Figure Legend Snippet: (A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).

Techniques Used:


Figure Legend Snippet:

Techniques Used: Blocking Assay, Recombinant, Electron Microscopy, Plasmid Preparation, Red Blood Cell Lysis, Protease Inhibitor, SYBR Green Assay, Transfection, Gene Expression, Software, Microscopy, Irradiation, Flow Cytometry



Similar Products

90
GenScript corporation arid4b sgrna sequences
(A) Genotype distribution of progenies from the mating of <t>Arid4b</t> +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.
Arid4b Sgrna Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/arid4b sgrna sequences/product/GenScript corporation
Average 90 stars, based on 1 article reviews
arid4b sgrna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


(A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Staining

(A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Transplantation Assay, Injection, Irradiation, Flow Cytometry

(A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Immunofluorescence, Staining, Flow Cytometry, Immunohistochemistry, Western Blot

(A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques:

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet:

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Blocking Assay, Recombinant, Electron Microscopy, Plasmid Preparation, Red Blood Cell Lysis, Protease Inhibitor, SYBR Green Assay, Transfection, Gene Expression, Software, Microscopy, Irradiation, Flow Cytometry